CPS 006G, Fall 2004, Shotgun IV

Part IV

After you've added this code correctly, you can test your code with the simplefasta.txt file which should create this strand:

    tgaaaattcctttctattttaggcccatgcaatggcattagggcggttaa

You'll need to make two changes in this version of the program.

1. Change the classes as needed so that the threshold for determining matches is not hard-wired to 12, but is determined in the main method that runs the shotgun simulation. You'll need to make changes in ShotgunReconstructor for this to happen.

2. Develop one (or two, see below) new IStrand implementations that are faster. The first should use regionMatches and/or other string methods to determine if two strands overlap. Your goal is to make to develop an implementation that is correct, but which yields much faster shotgun reconstruction. The points/score you earn on this part are based 80% on correctness and 20% on the efficiency of your code (it should be faster).

   You'll need to create a new IStrandFactory implementation as well, and configure the reading class appropriately.

3. You should experiment with your new implementation by making the contains method always return false and moving its functionality into the merge method. (This is a code-refactoring). In this case you'll want to change code in ShotgunReconstructor too so that the reduce method doesn't iterator over all strands, but simply returns false.

   This should save lots of time since you'll avoid iterating over the strings twice: once for contains and once for merge. Since the merge method already looks for matches, you could change it to look for containing matches too. In this case you can return the containing strand rather than creating a new one.

   In your final README/write-up you should discuss if your refactoring was successful, and whether it reduced the time for completing a shotgun reconstruction.

4. For A or A+ credit you should develop an implementation based on the biojava Sequence, SymbolList, and Edit classes. These can be found in the biojava API, in the org.biojava.bio.seq package. The idea is to create an IStrand implementation that is based on the Sequence returned when reading, this will avoid, perhaps, creating strings for storing the DNA strands.

   The new IStrand implementation will store the Sequence, and use it and other biojava objects rather than Strings to do the merging and containing. You'll need to examine base-pairs in a sequence one-at-a-time, you might want to develop a method similar to the String method regionMatches for this purpose.